What is DNA methylation?
DNA methylation: distribution
- Cytidine and Adenine can be methylated
- In mammals, DNA methylation happens at CpG dinucleotides
- In mammals, DNA methylation rarely happens at CHH dinucleotides (H= A/G/T)
DNA methylation: evolution and development
- Plants have cytidine and adenine methylation
- Yeast is typically unmethylated (but some species have some)
- In mice, DNMT knockouts are embryonic lethal
DNA methylation: heritability
- The classic "epigenetic" mark
- Heritability: DNA Methyltransferases (DNMTs) copy from parent to child strand
- Maintenance methyltransferases: DNMT1
- De novo methyltransferase: DNMT3(a/b)
DNA methylation: hemimethylation
DNA methylation: imprinting
- "Imprinted" regions are parent-specific, binary allele-specific methylation
- Classic example: X-inactivation. DNA methylation is critical for maintenance but not establishment of the silent X.
DNA methylation: signal levels
- An individual cytosine is either methylated or not methylated
- Continuous measures arise via averaging at multiple resolutions: strands, alleles, cells, cell-types and genomic regions
DNA methylation: gene regulation
- Many (not all) transcription factors are methylation-sensitive
DNA methylation in cancer
- Most cancers have globally decreased methylation with punctate increased methylation
- azacytidine is a cytidine analog used in cancer treatment.
DNA demethylation
In the active case, appears to happen via hydroxymethylation

Ivanov et al. 2014
DNA methylation: measuring
- MeDIP assays rely on methylation-sensitive antibodies
- bisulfite microarrays use base-pair hybridization
- bisulfite sequencing is the de facto standard
Bisulfite-seq
Bisulfite-seq
Bisulfite-seq: Alignment issues
CTGACTGTCGATCGATCGGATCATAGTCAGCTAGCATTTTGGGACCGCG - Reference genome
| | | |
TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATCGCG - Bisulfite-converted
How can you align this sequence?
Convert the reference!
TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATTGTG - Converted reference
| | | |
TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATTGTG - Fully converted
RRBS: Reduced Representation Bisulfite Sequencing

(Baheti et al. 2016)
Bisulfite-seq data
Concluding thoughts
- The time-scale balance between regulation and memory
- A covalent modification to DNA makes a clinically useful biomarker
- Methylation data is fundamentally different from RNA, more similar to genetic variation, because its number is fixed in a cell