DNA methylation and bisulfite-seq

Nathan Sheffield, PhD
www.databio.org/slides

What is DNA methylation?

DNA methylation: distribution

  • Cytidine and Adenine can be methylated
  • In mammals, DNA methylation happens at CpG dinucleotides
  • In mammals, DNA methylation rarely happens at CHH dinucleotides (H= A/G/T)

DNA methylation: evolution and development

  • Plants have cytidine and adenine methylation
  • Yeast is typically unmethylated (but some species have some)
  • In mice, DNMT knockouts are embryonic lethal

DNA methylation: heritability

  • The classic "epigenetic" mark
  • Heritability: DNA Methyltransferases (DNMTs) copy from parent to child strand
  • Maintenance methyltransferases: DNMT1
  • De novo methyltransferase: DNMT3(a/b)

DNA methylation: hemimethylation

DNA methylation: imprinting

  • "Imprinted" regions are parent-specific, binary allele-specific methylation
  • Classic example: X-inactivation. DNA methylation is critical for maintenance but not establishment of the silent X.

DNA methylation: signal levels

  • An individual cytosine is either methylated or not methylated
  • Continuous measures arise via averaging at multiple resolutions: strands, alleles, cells, cell-types and genomic regions

DNA methylation: gene regulation

  • Many (not all) transcription factors are methylation-sensitive

DNA methylation in cancer

  • Most cancers have globally decreased methylation with punctate increased methylation
  • azacytidine is a cytidine analog used in cancer treatment.

DNA demethylation

In the active case, appears to happen via hydroxymethylation

Ivanov et al. 2014

DNA methylation: measuring

  • MeDIP assays rely on methylation-sensitive antibodies
  • bisulfite microarrays use base-pair hybridization
  • bisulfite sequencing is the de facto standard

Bisulfite-seq

Bisulfite-seq

Bisulfite-seq: Alignment issues
CTGACTGTCGATCGATCGGATCATAGTCAGCTAGCATTTTGGGACCGCG - Reference genome
|       |                                    | |
TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATCGCG - Bisulfite-converted

How can you align this sequence? Convert the reference! 
TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATTGTG - Converted reference
|       |                                    | |
TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATTGTG - Fully converted

RRBS: Reduced Representation Bisulfite Sequencing


(Baheti et al. 2016)
Bisulfite-seq data

Concluding thoughts

  • The time-scale balance between regulation and memory
  • A covalent modification to DNA makes a clinically useful biomarker
  • Methylation data is fundamentally different from RNA, more similar to genetic variation, because its number is fixed in a cell