Epigenome tools: open chromatin and DNA methylation

by Nathan Sheffield

Slides at http://databio.org/slides/epigenome_tools.html

What is epigenetics?

There has always been a place in biology for words that have different meanings for different people. Epigenetics is an extreme case, because it has several meanings with independent roots. (Bird 2007)
The meaning of the term "epigenetics" has itself undergone an evolution. (Felsenfeld 2014)

What is epigenetics?

the causal study of embryological development (Waddington 1957)
The study of mitotically and/or meiotically heritable changes in gene function that cannot be explained by changes in DNA sequence
(Riggs et al. 1996)
a change in the state of expression of a gene that does not involve a mutation, but that is nevertheless inherited in the absence of the signal (or event) that initiated the change. (Ptashne and Gant 2002)
the structural adaptation of chromosomal regions so as to register, signal or perpetuate altered activity states. (Bird 2007)

What is epigenetics?

Epigenetics refers to changes in gene regulation brought about through modifications to the DNA's packaging proteins or the DNA molecules themselves without changing the underlying sequence.
(Lord and Cruchaga 2014, Nature Neuroscience)
the study of the mechanisms that allow cells to translate the nearly constant genome content of a multicellular organism into multiple functional and stable cellular conditions (Schwartzman and Tanay 2015)
Epigenetic processes are a means by which endogenous and exoge­nous cues exert long-term control over gene expression (Nugent et al. 2015)

What is epigenetics?

The pop definition:
The word literally means "on top of genetics," and it's the study of how individual genes can be activated or deactivated by life experiences. (The Week, 2013)

What is epigenomics?

Epigenomics is the study of the physical modifications, associations and conformations of genomic DNA sequences (Schwartzman and Tanay 2015)
Epigenomics is the study of the chemical modification and physical conformation of cellular DNA and bound proteins (Sheffield 2017)
The word "epigenome" lacks the baggage of heritability.

Rosa et al. 2013

ATAC-seq

Identifies open chromatin

Bisulfite-seq

Quantifies DNA methylation

ATAC-seq

Open chromatin
  • DNase: classic 'gold standard' to identify open chromatin
  • Open chromatin coincides with active regulatory DNA
  • ... but exact annotation or binding is not provided
  • ATAC-seq simplified and popularized the concept

DNase-seq: Biology

ATAC-seq: Experiment (Buenrostro et al. 2013)

Chromatin and transcription factors (Thurman et al. 2012)

ATAC-seq: Data overview

Footprinting

Vernon et al. 2012
Single-cell ATAC

Buenrostro et al. 2015
ATAC-seq: Data analysis
  • linking to gene expression: it's complicated
  • differential open chromatin provides regulatory clues
  • motif searches in cross-cell-type clustering
  • distal vs. proximal peaks

Bisulfite-seq

DNA Methylation
  • The classic "epigenetic" mark
  • Heritability: DNA Methyltransferases (DNMTs) copy from parent to child strand
  • In mammals, DNA methylation happens at CpG dinucleotides
  • Classic example: X-inactivation
  • Knockouts are embryonic lethal
Hydroxymethylation

Ivanov et al. 2014
Bisulfite-seq: Alignment issues
CTGACTGTCGATCGATCGGATCATAGTCAGCTAGCATTTTGGGACCGCG - Reference genome
TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATCGCG - Bisulfite-converted

How can you align this sequence?
Bisulfite-seq data
Bisulfite-seq: Advanced analysis techniques
A case study: Ewing sarcoma

Locus Overlap Analysis (LOLA)

Epigenome signals are not in isolation
Thanks for listening!

Slides at http://databio.org/slides/epigenome_tools.html