Epigenome tools: ATAC-seq and Bisulfite-seq

Nathan Sheffield, PhD

www.databio.org/slides

What is epigenomics?

Epigenomics is the study of the physical modifications, associations and conformations of genomic DNA sequences (Schwartzman and Tanay 2015)

Epigenomics is the study of the chemical modification and physical conformation of cellular DNA and bound proteins

Rosa and Shaw 2013

The epigenome

If we can measure how DNA is packaged,
we can understand what a cell is doing

Epigenomics

the study of the chemical modification and physical conformation of cellular DNA and bound proteins

Epigenetics

???

What is epigenetics?

the causal study of embryological development (Waddington 1957, The strategy of the genes)

The study of mitotically and/or meiotically heritable changes in gene function that cannot be explained by changes in DNA sequence
(Riggs et al. 1996)

a change in the state of expression of a gene that does not involve a mutation, but that is nevertheless inherited in the absence of the signal (or event) that initiated the change. (Ptashne and Gant 2002)

What is epigenetics?

the structural adaptation of chromosomal regions so as to register, signal or perpetuate altered activity states. (Bird 2007)

Epigenetics refers to changes in gene regulation brought about through modifications to the DNA's packaging proteins or the DNA molecules themselves without changing the underlying sequence.
(Lord and Cruchaga 2014, Nature Neuroscience)

the study of the mechanisms that allow cells to translate the nearly constant genome content of a multicellular organism into multiple functional and stable cellular conditions (Schwartzman and Tanay 2015)

What is epigenetics?

The word literally means "on top of genetics," and it's the study of how individual genes can be activated or deactivated by life experiences. (The Week, 2013)

Epigenomics

the study of the chemical modification and physical conformation of cellular DNA and bound proteins

Epigenetics

???

What does the genome encode?

Chromatin accessibility

ATAC-seq

DNA methylation

Bisulfite-seq

What is regulatory DNA?

Regulatory DNA is a decision-maker

Challenges to studying regulatory DNA

Variation: age, cell-type, environment, disease
Amount: 1-2% protein coding vs 8-20%? regulatory
Target: what gene does it affect?
Function: is it a promoter, silencer, insulator, enhancer?
Rigidity: genetic code vs TF motifs

Genetic code

Transcription factor motif

We can computationally identify genes and even predict function. Regulatory DNA is more difficult.

Chromatin accessibility

Chromatin accessibility is the degree to which nuclear macromolecules are able to physically contact chromatinized DNA...

[It] is determined by the occupancy and topological organization of nucleosomes as well as other chromatin-binding factors that occlude access to DNA.

Klemm et al. 2019

How can we identify regulatory DNA?

https://en.wikipedia.org/wiki/Chromatin

How can we identify regulatory DNA?

Alberts 2002

How can we identify regulatory DNA?

ChIP: Chromatin immunoprecipitation
DNase: classic 'gold standard' to identify open chromatin
ATAC: Assay for transposase-accessible chromatin
FAIRE: Formaldehyde-assisted isolation of regulatory elements

Trends

ChIP-seq

DNase-seq: Biology

ATAC-seq: Experiment (Buenrostro et al. 2013)

Transposase Tn5 protein (Reznikoff 2008)

Chromatin and transcription factors (Thurman et al. 2012)

Chromatin accessibility biology summary

Open chromatin usually coincides with active regulatory DNA
... but exact annotation or binding is not provided
The advantage and disadvantage of ChIP seq is in its target. It also requires antibodies and provides more diffuse signal
ATAC is pronounced 'attack'

Basic data analysis steps

1. Trim adapters (fastq -> fastq)
2. Align reads (fastq -> bam)
3. Shift reads (bam -> bam)
4. Call peaks (bam -> bed)

ATAC-seq: 9 base duplication (Reznikoff 2008)

Tn5 molecular biology

What is DNA methylation?

DNA methylation: distribution

Cytidine and Adenine can be methylated
In mammals, DNA methylation happens at CpG dinucleotides
In mammals, DNA methylation rarely happens at CHH dinucleotides (H= A/G/T)

DNA methylation: evolution and development

Plants have cytidine and adenine methylation
Yeast is typically unmethylated (but some species have some)
In mice, DNMT knockouts are embryonic lethal

DNA methylation: heritability

The classic "epigenetic" mark
Heritability: DNA Methyltransferases (DNMTs) copy from parent to child strand
Maintenance methyltransferases: DNMT1
De novo methyltransferase: DNMT3(a/b)

DNA methylation: hemimethylation

DNA methylation: imprinting

"Imprinted" regions are parent-specific, binary allele-specific methylation
Classic example: X-inactivation. DNA methylation is critical for maintenance but not establishment of the silent X.

DNA methylation: signal levels

An individual cytosine is either methylated or not methylated
Continuous measures arise via averaging at multiple resolutions: strands, alleles, cells, cell-types and genomic regions

DNA methylation: gene regulation

Many (not all) transcription factors are methylation-sensitive

DNA methylation in cancer

Most cancers have globally decreased methylation with punctate increased methylation
azacytidine is a cytidine analog used in cancer treatment.

DNA demethylation

In the active case, appears to happen via hydroxymethylation

Ivanov et al. 2014

DNA methylation: measuring

MeDIP assays rely on methylation-sensitive antibodies
bisulfite microarrays use base-pair hybridization
bisulfite sequencing is the de facto standard

Bisulfite-seq

Bisulfite-seq: Alignment issues

CTGACTGTCGATCGATCGGATCATAGTCAGCTAGCATTTTGGGACCGCG - Reference genome
|       |                                    | |
TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATCGCG - Bisulfite-converted

How can you align this sequence? Convert the reference!

TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATTGTG - Converted reference
|       |                                    | |
TTGATTGTTGATTGATTGGATTATAGTTAGTTAGTATTTTGGGATTGTG - Fully converted